Editing CRISPR and Genome Editing (section)

== <span style="color: #FFFFFF;">Applying</span> ==
'''Modeling 'The CRISPR Cut' (Finding the target sequence):'''
<syntaxhighlight lang="python">
def find_crispr_target(genome, guide_rna, pam="NGG"):
    """
    Simulates how CRISPR searches for its target.
    """
    # PAM must follow the target for Cas9 to work
    target_length = len(guide_rna)
    matches = []
    
    # Simple search
    for i in range(len(genome) - target_length - 3):
        snippet = genome[i:i+target_length]
        potential_pam = genome[i+target_length:i+target_length+3]
        
        # Check match and PAM (NGG: N is anything, GG is required)
        if snippet == guide_rna and potential_pam[1:] == "GG":
            matches.append(i)
            
    return {
        "Target Found": "YES" if matches else "NO",
        "Positions": matches
    }

dna = "ATGCGTAAAGGGCTAGCGTAAA" # A small DNA strand
guide = "CGTAAA"
print(find_crispr_target(dna, guide))
</syntaxhighlight>

; CRISPR Landmarks
: '''The Yogurt Discovery (2007)''' → Scientists at a yogurt company realized that bacteria use CRISPR to "Remember" and "Kill" viruses that attack their fermentation vats.
: '''Doudna & Charpentier (2012)''' → The landmark paper that showed CRISPR could be used as a general-purpose tool for editing any DNA (Nobel Prize winners).
: '''Sickle Cell Cure (2023)''' → The first FDA-approved CRISPR therapy, which "Turns On" a fetal hemoglobin gene to cure a lifelong blood disorder.
: '''The 'Designer Baby' Controversy (2018)''' → He Jiankui's announcement of the first CRISPR-edited babies, which sparked global outrage and led to new international regulations.
</div>

<div style="background-color: #8B4500; color: #FFFFFF; padding: 20px; border-radius: 8px; margin-bottom: 15px;">